pcr genotyping  (Transnetyx)

Journal: Microbiology Spectrum

Article Title: Gasdermin E is dispensable for H1N1 influenza virus pathogenesis in mice

doi: 10.1128/spectrum.02472-25

Figure Lengend Snippet: PR8 H1N1 IAV pathogenesis is similar in WT and Gsdme -/- mice. ( A–E ) WT and Gsdme -/- mice were infected with 50 TCID50 of PR8 intranasally. ( A ) Western blot of lung lysates. Each lane represents one individual mouse. ( B ) PCR genotyping of WT and Gsdme -/- mice. ( C ) Viral titers (log 10 [TCID50]) of lung homogenates taken on day 7 post-infection (WT n = 11, Gsdme -/- n = 11; error bars represent SEM; not significant by unpaired t -test). ( D ) Weight loss measurements (WT n = 20 and Gsdme -/- n = 17 for days 0–7; WT n = 10 and Gsdme -/- n = 9 for days 8–14; each dot is an average of individual mouse weights normalized to 100% relative to day 0; error bars indicate SEM; no significant differences between genotypes at any time point by two-way ANOVA followed by Bonferroni’s multiple comparisons test). ( E ) Survival analysis (WT n = 10, Gsdme -/- n = 9; non-significant by log-rank Mantel-Cox test). ( F ) Cytokine quantifications on lung homogenates taken at day 7 post-infection (WT n = 6, Gsdme -/- n = 6; error bars indicate SEM; non-significant by unpaired t -test).

Article Snippet: Gsdme -/- mice were validated by Western blotting and standard PCR-based genotyping according to Jackson Laboratories (PCR primers include WT forward: 5′- CATGCGAAAAGAAGCTGTCA -3′, common reverse: 5′- CCAATCCCATGCTTCGAC -3′, mutant forward: 5′- GATCCTTTCAGGTTGGCAGT -3′).

Techniques: Infection, Western Blot